recipes that save time
https://bcbio-nextgen.readthedocs.io/en/latest/contents/configuration.html#adding-custom-genomes
Genomic sequence: ftp://ftp.ensembl.org/pub/release-102/fasta/homo_sapiens/dna/Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz
Annotation: ftp://ftp.ensembl.org/pub/release-102/gff3/homo_sapiens/Homo_sapiens.GRCh38.102.gff3.gz
https://bioinformatics.stackexchange.com/questions/540/what-ensembl-genome-version-should-i-use-for-alignments-e-g-toplevel-fa-vs-p
Use “primary assembly” not “top level.”
Client had provided virus gff (for a specific strain, HSV-1_kos) that he had edited to remove repeat sequences, and a similarly edited reference
KOSnorepeat.fa
kosNorepeatFinal.gff
Viral sequences are not available on ensembl (with the exception of SARS-CoV-2)
You can find them at NCBI here:
https://www.ncbi.nlm.nih.gov/nuccore/JQ673480.1
To the right side of the title, there is a “Send to”. Click that. Choose “Complete Record” . Under “Choose Destination”, choose “File”. Under “Format” there is a menu. Choose “GFF3” in that menu and click Create File to get the annotation
First converted the hsv gff3 file (it is gff version 3 in header) to gtf using cufflinks
use gffread -F -T -o
module spider cufflinks
module load cufflinks/2.2.1
gffread -h
gffread kosNorepeatFinal.gff -F -T -o kosNorepeatFinal.gtf
This the gtf head
| gi | 380776962 | gb | JQ673480.1 | GenBank exon 186 860 . + . transcript_id “HHV1gp003.t01”; protein_id “AFE62828.1”; Dbxref “GI:380776965”; Name “UL1”; codon_start “1”; locus_tag “HHV1gp003”; product “envelope glycoprotein L”; translation “length.224”; |
| gi | 380776962 | gb | JQ673480.1 | GenBank exon 733 1737 . + . transcript_id “HHV1gp004.t01”; protein_id “AFE62829.1”; Dbxref “GI:380776966”; Name “UL2”; codon_start “1”; locus_tag “HHV1gp004”; product “uracil-DNA glycosylase”; translation “length.334”; |
Replace the virus fasta header and gtf entries with JQ673480.1, the NCBI HHV-1 kos strain ID
>JQ673480.1 GGGCCCCCCCCAAAACACACCCCCCGGGGGTCGCGCGCGGCCCTTTAAAGGCGGGCGGCGGGTATATAAA CCAACGAAAAGCGCGGGAACGGGGATACGGGGCTTGTGTGGCACGACGTCGTGGTTGTGTTACTGGGCAA ACACTTGGGGACTGTAGGTTTCTGTGGGTGCCGACCCTAGGCGCTATGGGGATTTTGGGTTGGGTCGGGC TTATTGCCGTTGGGGTTTTGTGTGTGCGGGGGGGCTTGTCTTCAACCGAATATGTTATTCGGAGTCGGGT GGCTCGAGAGGTGGGGGATATATTAAAGGTGCCTTGTGTGCCGCTCCCGTCTGACGATCTTGATTGGCGT TACGAGACCCCCTCGGCTATAAACTATGCTTTGATAGACGGTATATTTTTGCGTTATCACTGTCCCGGAT
JQ673480.1 GenBank exon 186 860 . + 0 gene_id “HHV1gp003.t01”; transcript_id “HHV1gp003.t01”; protein_id “AFE62828.1”; Dbxref “GI:380776965”; gene_name “UL1”; codon_start “0”; locus_tag “HHV1gp003”; product “envelope glycoprotein L”; translation “length.224”; gbkey “exon,Gene”; JQ673480.1 GenBank exon 733 1737 . + 0 gene_id “HHV1gp004.t01”; transcript_id “HHV1gp004.t01”; protein_id “AFE62829.1”; Dbxref “GI:380776966”; gene_name “UL2”; codon_start “0”; locus_tag “HHV1gp004”; product “uracil-DNA glycosylase”; translation “length.334”; gbkey “exon,Gene”;
The gtf requires the transcript_id field, and be careful of spacing after the ; in the gtf file
Star will need to see “exon” in the third field to count viral transcripts
gunzip and cat the mammal and virus files
cat ensembl_genomes/Homo_sapiens.GRCh38.dna.primary_assembly.fa HSV-1_genome/KOSnorepeat.fa > catted_genomes/GRCh38.p13.102_HSV-1_kos.fa
cat ensembl_genomes/Homo_sapiens.GRCh38.102.gtf HSV-1_genome/kosNorepeatEdited.gtf > catted_genomes/GRCh38.p13.102_HSV-1_kos.gtf
/n/shared_db/bcbio/biodata/genomes/Hsapiens/
#!/bin/bash
#SBATCH --job-name=setupGenome # Job name
#SBATCH --partition=priority # Partition name
#SBATCH --time=1-00:00 # Runtime in D-HH:MM format
#SBATCH --nodes=1 # Number of nodes (keep at 1)
#SBATCH --ntasks=1 # Number of tasks per node (keep at 1)
#SBATCH --cpus-per-task=4 # CPU cores requested per task (change for threaded jobs)
#SBATCH --mem=128G # Memory needed per node (total)
#SBATCH --error=jobid_%j.err # File to which STDERR will be written, including job ID
#SBATCH --output=jobid_%j.out # File to which STDOUT will be written, including job ID
#SBATCH --mail-type=ALL # Type of email notification (BEGIN, END, FAIL, ALL)
bcbio_setup_genome.py \
-c 4 \
-f /n/data1/cores/bcbio/PIs/don_coen/Emilia_Vanni/vanni_bulk_RNA-Seq_HSV1_human-mouse_hbc04057/catted_genomes/GRCh38.p13.102_HSV-1_kos.fa \
-g /n/data1/cores/bcbio/PIs/don_coen/Emilia_Vanni/vanni_bulk_RNA-Seq_HSV1_human-mouse_hbc04057/catted_genomes/GRCh38.p13.102_HSV-1_kos.gtf \
-i star seq \
-n Hsapiens \
-b GRCh38.p13.102_HSV-1_kos \
--buildversion GRCh38.p13.102_HSV-1_kos
featureCounts/annotated_combined.counts
use ready.bam files
bamtools filter -tag NH:1 -in my.bam -out my.filtered.bam
bamtools filter -tag NH:1 -in LIB042801-ready.bam -out post_filt_LIB042801_ready.bam
samtools sort post_filt_LIB042801_ready.bam -o sample.sorted.LIB042801_ready.bam
or do them all
cp all the ready.bam to a dir
filter and sort
#!/bin/bash
#SBATCH --job-name=bamtoolsfilter # Job name
#SBATCH --partition=priority # Partition name
#SBATCH --time=1-00:00 # Runtime in D-HH:MM format
#SBATCH --nodes=1 # Number of nodes (keep at 1)
#SBATCH --ntasks=1 # Number of tasks per node (keep at 1)
#SBATCH --cpus-per-task=4 # CPU cores requested per task (change for threaded jobs)
#SBATCH --mem=128G # Memory needed per node (total)
#SBATCH --error=jobid_%j.err # File to which STDERR will be written, including job ID
#SBATCH --output=jobid_%j.out # File to which STDOUT will be written, including job ID
#SBATCH --mail-type=ALL # Type of email notification (BEGIN, END, FAIL, ALL)
module load gcc/6.2.0
module load bamtools/2.4.1
module load samtools/1.10
for file in *.bam; do
bamtools filter -tag NH:1 -in $file -out "`basename $file .bam`filtered.bam"
done
for file in *filtered.bam; do
samtools sort $file -o "`basename $file .bam`sorted.bam"
done
#!/bin/bash
#SBATCH --job-name=featureCounts # Job name
#SBATCH --partition=priority # Partition name
#SBATCH --time=1-00:00 # Runtime in D-HH:MM format
#SBATCH --nodes=1 # Number of nodes (keep at 1)
#SBATCH --ntasks=1 # Number of tasks per node (keep at 1)
#SBATCH --cpus-per-task=4 # CPU cores requested per task (change for threaded jobs)
#SBATCH --mem=128G # Memory needed per node (total)
#SBATCH --error=jobid_%j.err # File to which STDERR will be written, including job ID
#SBATCH --output=jobid_%j.out # File to which STDOUT will be written, including job ID
#SBATCH --mail-type=ALL # Type of email notification (BEGIN, END, FAIL, ALL)
featureCounts -T 4 -p -t exon -g gene_id -F GTF \
-a /n/data1/cores/bcbio/PIs/don_coen/Emilia_Vanni/vanni_bulk_RNA-Seq_HSV1_human-mouse_hbc04057/catted_genomes/GRCh38.p13.102_HSV-1_kos.gtf \
-o featurecounts \
LIB042801-readyfilteredsorted.bam LIB042802-readyfilteredsorted.bam LIB042803-readyfilteredsorted.bam
then cut to get output
cut -f1,7-8 featurecounts.txt > cutFeaturecounts.txt