knowledgebase

recipes that save time

View the Project on GitHub hbc/knowledgebase

Building hybrid mammal virus genome; human with HHV-1 (HSV-1)



https://bcbio-nextgen.readthedocs.io/en/latest/contents/configuration.html#adding-custom-genomes

  1. Get the genomes and annotations from ensembl with wget on the transfer node

Genomic sequence: ftp://ftp.ensembl.org/pub/release-102/fasta/homo_sapiens/dna/Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz

Annotation: ftp://ftp.ensembl.org/pub/release-102/gff3/homo_sapiens/Homo_sapiens.GRCh38.102.gff3.gz

https://bioinformatics.stackexchange.com/questions/540/what-ensembl-genome-version-should-i-use-for-alignments-e-g-toplevel-fa-vs-p

Use “primary assembly” not “top level.”

Client had provided virus gff (for a specific strain, HSV-1_kos) that he had edited to remove repeat sequences, and a similarly edited reference

KOSnorepeat.fa

kosNorepeatFinal.gff

Viral sequences are not available on ensembl (with the exception of SARS-CoV-2)

You can find them at NCBI here:

https://www.ncbi.nlm.nih.gov/nuccore/JQ673480.1

To the right side of the title, there is a “Send to”. Click that. Choose “Complete Record” . Under “Choose Destination”, choose “File”. Under “Format” there is a menu. Choose “GFF3” in that menu and click Create File to get the annotation



  1. Edit the gff file, to make the human and virus gtf formats match in the concatenated files

First converted the hsv gff3 file (it is gff version 3 in header) to gtf using cufflinks

use gffread -F -T -o

	module spider cufflinks
	module load cufflinks/2.2.1
	gffread -h

	gffread  kosNorepeatFinal.gff -F -T -o kosNorepeatFinal.gtf


This the gtf head

gi 380776962 gb JQ673480.1 GenBank exon 186 860 . + . transcript_id “HHV1gp003.t01”; protein_id “AFE62828.1”; Dbxref “GI:380776965”; Name “UL1”; codon_start “1”; locus_tag “HHV1gp003”; product “envelope glycoprotein L”; translation “length.224”;
gi 380776962 gb JQ673480.1 GenBank exon 733 1737 . + . transcript_id “HHV1gp004.t01”; protein_id “AFE62829.1”; Dbxref “GI:380776966”; Name “UL2”; codon_start “1”; locus_tag “HHV1gp004”; product “uracil-DNA glycosylase”; translation “length.334”;

Replace the virus fasta header and gtf entries with JQ673480.1, the NCBI HHV-1 kos strain ID

>JQ673480.1 GGGCCCCCCCCAAAACACACCCCCCGGGGGTCGCGCGCGGCCCTTTAAAGGCGGGCGGCGGGTATATAAA CCAACGAAAAGCGCGGGAACGGGGATACGGGGCTTGTGTGGCACGACGTCGTGGTTGTGTTACTGGGCAA ACACTTGGGGACTGTAGGTTTCTGTGGGTGCCGACCCTAGGCGCTATGGGGATTTTGGGTTGGGTCGGGC TTATTGCCGTTGGGGTTTTGTGTGTGCGGGGGGGCTTGTCTTCAACCGAATATGTTATTCGGAGTCGGGT GGCTCGAGAGGTGGGGGATATATTAAAGGTGCCTTGTGTGCCGCTCCCGTCTGACGATCTTGATTGGCGT TACGAGACCCCCTCGGCTATAAACTATGCTTTGATAGACGGTATATTTTTGCGTTATCACTGTCCCGGAT

JQ673480.1 GenBank exon 186 860 . + 0 gene_id “HHV1gp003.t01”; transcript_id “HHV1gp003.t01”; protein_id “AFE62828.1”; Dbxref “GI:380776965”; gene_name “UL1”; codon_start “0”; locus_tag “HHV1gp003”; product “envelope glycoprotein L”; translation “length.224”; gbkey “exon,Gene”; JQ673480.1 GenBank exon 733 1737 . + 0 gene_id “HHV1gp004.t01”; transcript_id “HHV1gp004.t01”; protein_id “AFE62829.1”; Dbxref “GI:380776966”; gene_name “UL2”; codon_start “0”; locus_tag “HHV1gp004”; product “uracil-DNA glycosylase”; translation “length.334”; gbkey “exon,Gene”;

The gtf requires the transcript_id field, and be careful of spacing after the ; in the gtf file

Star will need to see “exon” in the third field to count viral transcripts



  1. gunzip and cat the mammal and virus files

    cat ensembl_genomes/Homo_sapiens.GRCh38.dna.primary_assembly.fa HSV-1_genome/KOSnorepeat.fa > catted_genomes/GRCh38.p13.102_HSV-1_kos.fa
    
    
    cat ensembl_genomes/Homo_sapiens.GRCh38.102.gtf HSV-1_genome/kosNorepeatEdited.gtf > catted_genomes/GRCh38.p13.102_HSV-1_kos.gtf
    



  1. bcbio_setup_genome to build the genome, it will automatically put it in the right place, here, for example:

/n/shared_db/bcbio/biodata/genomes/Hsapiens/

#!/bin/bash

#SBATCH --job-name=setupGenome         # Job name
#SBATCH --partition=priority           # Partition name
#SBATCH --time=1-00:00                 # Runtime in D-HH:MM format
#SBATCH --nodes=1                      # Number of nodes (keep at 1)
#SBATCH --ntasks=1                     # Number of tasks per node (keep at 1)
#SBATCH --cpus-per-task=4              # CPU cores requested per task (change for threaded jobs)
#SBATCH --mem=128G                     # Memory needed per node (total)
#SBATCH --error=jobid_%j.err           # File to which STDERR will be written, including job ID
#SBATCH --output=jobid_%j.out          # File to which STDOUT will be written, including job ID
#SBATCH --mail-type=ALL                # Type of email notification (BEGIN, END, FAIL, ALL)

bcbio_setup_genome.py \
-c 4 \
-f /n/data1/cores/bcbio/PIs/don_coen/Emilia_Vanni/vanni_bulk_RNA-Seq_HSV1_human-mouse_hbc04057/catted_genomes/GRCh38.p13.102_HSV-1_kos.fa \
-g /n/data1/cores/bcbio/PIs/don_coen/Emilia_Vanni/vanni_bulk_RNA-Seq_HSV1_human-mouse_hbc04057/catted_genomes/GRCh38.p13.102_HSV-1_kos.gtf \
-i star seq \
-n Hsapiens \
-b GRCh38.p13.102_HSV-1_kos \
--buildversion GRCh38.p13.102_HSV-1_kos



  1. After running alignment, view output, i.e

featureCounts/annotated_combined.counts



  1. filter out multimapped reads, sort, re-run featureCounts

use ready.bam files

	bamtools filter -tag NH:1 -in my.bam -out my.filtered.bam

	bamtools filter -tag NH:1 -in LIB042801-ready.bam -out post_filt_LIB042801_ready.bam


	samtools sort post_filt_LIB042801_ready.bam -o sample.sorted.LIB042801_ready.bam


or do them all

cp all the ready.bam to a dir

filter and sort

#!/bin/bash

#SBATCH --job-name=bamtoolsfilter      # Job name
#SBATCH --partition=priority           # Partition name
#SBATCH --time=1-00:00                 # Runtime in D-HH:MM format
#SBATCH --nodes=1                      # Number of nodes (keep at 1)
#SBATCH --ntasks=1                     # Number of tasks per node (keep at 1)
#SBATCH --cpus-per-task=4              # CPU cores requested per task (change for threaded jobs)
#SBATCH --mem=128G                     # Memory needed per node (total)
#SBATCH --error=jobid_%j.err           # File to which STDERR will be written, including job ID
#SBATCH --output=jobid_%j.out          # File to which STDOUT will be written, including job ID
#SBATCH --mail-type=ALL                # Type of email notification (BEGIN, END, FAIL, ALL)

module load gcc/6.2.0

module load bamtools/2.4.1

module load samtools/1.10


for file in *.bam; do
    bamtools filter -tag NH:1 -in $file -out "`basename $file .bam`filtered.bam"
done


for file in *filtered.bam; do

    samtools sort $file -o "`basename $file .bam`sorted.bam"
done



  1. run featureCounts
#!/bin/bash

#SBATCH --job-name=featureCounts       # Job name
#SBATCH --partition=priority           # Partition name
#SBATCH --time=1-00:00                 # Runtime in D-HH:MM format
#SBATCH --nodes=1                      # Number of nodes (keep at 1)
#SBATCH --ntasks=1                     # Number of tasks per node (keep at 1)
#SBATCH --cpus-per-task=4              # CPU cores requested per task (change for threaded jobs)
#SBATCH --mem=128G                     # Memory needed per node (total)
#SBATCH --error=jobid_%j.err           # File to which STDERR will be written, including job ID
#SBATCH --output=jobid_%j.out          # File to which STDOUT will be written, including job ID
#SBATCH --mail-type=ALL                # Type of email notification (BEGIN, END, FAIL, ALL)

featureCounts -T 4 -p -t exon -g gene_id -F GTF \
  -a /n/data1/cores/bcbio/PIs/don_coen/Emilia_Vanni/vanni_bulk_RNA-Seq_HSV1_human-mouse_hbc04057/catted_genomes/GRCh38.p13.102_HSV-1_kos.gtf \
  -o featurecounts \
  LIB042801-readyfilteredsorted.bam LIB042802-readyfilteredsorted.bam LIB042803-readyfilteredsorted.bam

then cut to get output

	cut -f1,7-8 featurecounts.txt > cutFeaturecounts.txt